rs1428400 chr5:7396850 G>C
- Sequence
ccgggcaccgctgcccgcagcgct[G/C]gaataggtcttccccgactcagcc
- ASB in cell types
- GM23248 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | -0.60 | 1.78 | 1.00 | |||
| 22RV1 (prostate carcinoma) | 1.83 | -0.86 | 2.00 |
Items per page:
1 – 2 of 2