rs14355 chr5:133104593 C>G
- Sequence
aataggtaatgtatggagcatttt[C/G]acttctaaatagttagatacagaa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- RELB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RELB_HUMAN | 1.77 | n/a | 1.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, diastolic blood pressure (dbp), hdl cholesterol, parkinsons disease, prop taste detection threshold, systolic blood pressure (sbp), triglycerides, urinary albumin-to-creatinine ratio
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Muscle_Skeletal, Nerve_Tibial, Pituitary, Testis, Thyroid, Whole_Blood