rs1438307 chr2:135741596 G>T
- Sequence
caggcgccgccgacgtgtcttagc[G/T]gttagtcatccctcttaccgcttt
- ASB in cell types
- CD14+ monocytes GM12878 (female B-cells lymphoblastoid cell line) MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line) foreskin keratinocyte
- ASB for transcription factors
- STAT1_HUMAN HCFC1_HUMAN CDN1B_HUMAN TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 3.61 | n/a | 2.00 | n/a | No Hit | |||
| HCFC1_HUMAN | n/a | 0.77 | 2.50 | n/a | n/a | |||
| CDN1B_HUMAN | 1.46 | 0.35 | 1.12 | n/a | n/a | |||
| TYY1_HUMAN | 2.78 | 0.12 | 1.75 | n/a | No Hit | |||
| FOXK2_HUMAN | -0.39 | 2.96 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, body mass index (bmi), celiac disease, cystatin c in serum, diabetic retinopathy in type 2 diabetes mellitus, eye color, fasting insulin, hdl cholesterol, height, homa-ir, late onset alzheimers disease, ldl cholesterol, lung function, forced expiratory volume in 1 second (fev1), pagets disease of bone, parkinsons disease, partial epilepsy, premature ovarian failure, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood