rs144055544 chr9:4759461 A>G
- Sequence
gatgcctgaggctcggaccccacc[A/G]gggatgaaggctgccgccagcgtg
- ASB in cell types
- KB (cervical adenocarcinoma) HeLa Kyoto (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KB (cervical adenocarcinoma) | 1.93 | -1.36 | 1.00 | |||
| HeLa Kyoto (cervical adenocarcinoma) | 1.39 | -0.22 | 2.00 |
Items per page:
1 – 2 of 2