rs1442293 chr15:78048104 C>G
- Sequence
ttaccaagaaaaccccaggccttg[C/G]agcaacccacagcccatactggaa
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) GM12878 (female B-cells lymphoblastoid cell line) macrophages form periferal blood
- ASB for transcription factors
- SPI1_HUMAN IKZF2_HUMAN ETS1_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.41 | 0.73 | 1.64 | n/a | No Hit | |||
| IKZF2_HUMAN | 2.46 | -2.37 | 1.00 | n/a | n/a | |||
| ETS1_HUMAN | 2.06 | -1.73 | 1.00 | n/a | No Hit | |||
| IKZF1_HUMAN | 2.27 | -0.30 | 1.00 | n/a | No Hit | |||
| FLI1_HUMAN | 2.29 | 0.57 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood