rs144238861 chr2:219134104 T>A
- Sequence
tgtctccattgccttatccattga[T/A]cgttctttaacagcctgctttctt
- ASB in cell types
- U937 (adult acute monocytic leukemia)
- ASB for transcription factors
- CEBPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPA_HUMAN | -4.19 | 2.48 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1