rs1458650 chr4:83644874 G>T
- Sequence
taatgtgacaacattgccagtagg[G/T]ggtgctgtttcacgtagcattaga
- ASB in cell types
- A549 (lung carcinoma) erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.35 | 0.96 | 1.03 | |||
| erythroid progenitors | -4.21 | 1.80 | 2.00 |
Items per page:
1 – 2 of 2