rs146254088 chr1:1000018 G>A
- Sequence
gtgccgggtggagcgcgccgccac[G/A]gaccacgggcgggctggcgggcga
- ASB in cell types
- HCC-1599(ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCC-1599(ductal breast carcinoma) | -0.05 | 1.20 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Whole_Blood