rs1468074 chr22:37696722 G>C
- Sequence
taaagccagcccagcggactgtcg[G/C]cagaatgaaccaacgggaaagagg
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) HUES64 (embryonic stem cells) GM19240 (B cells Lymphoblastoid Cell Lines) HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -0.40 | 1.62 | 1.00 | |||
| HUES64 (embryonic stem cells) | 2.46 | 0.85 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -1.35 | 1.45 | 1.00 | |||
| HeLa (cervical adenocarcinoma) | 1.77 | -0.54 | 1.50 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid, Whole_Blood