rs1468915 chr7:12188266 A>G
- Sequence
ggttataatttatagagattaaca[A/G]tgaatttgtaaaagaagagatcct
- ASB in cell types
- WA09 (embryonic stem cells)
- ASB for transcription factors
- NANOG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NANOG_HUMAN | -3.20 | 1.98 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP frontotemporal lobar degeneration with tdp-43 inclusions, frontotemporal lobar degeneration with tdp-43 inclusions (grn mutation carriers), frontotemporal lobar degeneration with tdp-43 inclusions (grn mutation negative), height, ldl cholesterol, total cholesterol, urinary albumin-to-creatinine ratio
GTEx eQTL Brain_Cerebellum, Heart_Left_Ventricle, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Whole_Blood