rs1475418 chr10:6648185 T>C
- Sequence
aggtgaactggaagagaagccccc[T/C]gggcaagcaaatatgccttttttt
- ASB in cell types
- GM17942 (lymphoblastoid cell) foreskin keratinocyte NALM-6 (adult B acute lymphoblastic leukemia)
- ASB for transcription factors
- COE1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COE1_HUMAN | 1.39 | -1.06 | 1.17 | -2.89 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP chronic kidney disease, comorbid depressive syndrome and alcohol dependence, maternal transmission distortion, triglycerides change with statins, variant creutzfeldt-jakob disease