rs1476161 chr17:8187590 A>G
- Sequence
atttatttcaagcttttcgtagca[A/G]ctggccggttagctcagttggtta
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HCASMC (Human coronary artery smooth muscle cells) GM12878 (female B-cells lymphoblastoid cell line) BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- TCF21_HUMAN HIRA_HUMAN TADBP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | n/a | 2.58 | 2.50 | n/a | n/a | |||
| HIRA_HUMAN | 1.46 | 0.35 | 1.14 | n/a | n/a | |||
| TADBP_HUMAN | 2.09 | -1.04 | 1.50 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, infant head circumference, ldl cholesterol, total cholesterol, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hippocampus, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Brain_Substantia_nigra, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pituitary, Spleen, Testis, Whole_Blood