rs1477966 chr8:53588210 A>T
- Sequence
atagcccatatttccgtctctgcc[A/T]tcatgacagaaagccagtgttgtc
- ASB in cell types
- MCF10CA1a (breast metastatic epithelial cells) gastroesophageal sphincter pancreas GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10CA1a (breast metastatic epithelial cells) | 3.43 | -3.22 | 1.00 | |||
| gastroesophageal sphincter | -1.34 | 1.34 | 1.00 | |||
| pancreas | -1.19 | 1.19 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 0.72 | -0.57 | 1.00 | |||
| tibial nerve | -1.64 | 2.19 | 1.00 |
Items per page:
1 – 5 of 5