rs148564513 chr10:96130103 A>G
- Sequence
gccgccatcagggactcgcaggca[A/G]tgggtactacgacaggtattcccc
- ASB for transcription factors
- ETS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ETS1_HUMAN | -2.66 | 2.57 | 1.00 | 1.35 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
