rs1485988 chr4:91840431 A>G
- Sequence
ggactaattgatagatttagcagt[A/G]taaacttcatcactagaggcagct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF7 WS8 cells iPS-derived dermal fibroblasts primary prostate cancer
- ASB for transcription factors
- FOXA1_HUMAN RARA_HUMAN HXB13_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -0.03 | 1.67 | 1.90 | 1.31 | Weak Concordant | |||
| RARA_HUMAN | -2.09 | 2.49 | 1.00 | n/a | No Hit | |||
| HXB13_HUMAN | -0.54 | 1.85 | 1.25 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP arthritis including non-rheumatoid, hdl cholesterol change with statins, ldl cholesterol, longstanding arthritis, primary rhegmatogenous retinal detachment, rheumatoid arthritis