rs1488503 chr7:95871210 C>T
- Sequence
caagctgttgtggggacagttctt[C/T]agtagcagggcctccatttctcaa
- ASB in cell types
- FT282 (normal human fallopian tube tissue)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.73 | 0.02 | 1.05 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, hip bone mineral density (bmd), infant head circumference, parkinsons disease, spine bone mineral density (bmd)