rs1493796 chr12:74537569 A>G
- Sequence
ttttccacttttcagaggatatca[A/G]ttaagcgtggctgctgaattcatt
- ASB in cell types
- HEK293 (embryonic kidney) thoracic aorta
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.06 | 1.06 | 1.99 | |||
| thoracic aorta | -1.41 | 1.41 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP paternal transmission distortion, tardive dyskinesia, transmission distortion, variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg