rs149777 chr7:36319373 G>A
- Sequence
gagtctcactctgttgcccaggct[G/A]gagtgcagtggtgggcaatctcag
- ASB in cell types
- spleen GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| spleen | 1.67 | -0.64 | 1.00 | |||
| GBM39 (Human brain tumor) | 0.03 | 1.65 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Mucosa, Liver, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis