rs149801 chr4:109591337 T>C
- Sequence
gtagctgggactacaggtgtgcgc[T/C]accacgcctggctaatttttgtat
- ASB in cell types
- TMD8 (diffuse large B-cell lymphoma) Ramos (Burkitt lymphoma)
- ASB for transcription factors
- TFE2_HUMAN ITF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TFE2_HUMAN | 2.71 | -2.78 | 1.00 | n/a | No Hit | |||
| ITF2_HUMAN | 2.63 | -4.96 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Spleen, Thyroid