rs1499085 chr3:3337216 G>A
- Sequence
ctaaagaaaactaagctataccac[G/A]agcctgtttgcttctaacacatac
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | -0.81 | 1.69 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cognitive response to topiramate treatment as measured by the animals cognitive test, cystatin c in serum, fasting blood glucose, hdl cholesterol change with statins