rs150133097 chr19:32405307 G>A
- Sequence
agagcagggaacggcagaaaggag[G/A]aaggagggggagttccgtaaatca
- ASB in cell types
- primary B-CLL cells SEM (childhood B acute lymphoblastic leukemia)
- ASB for transcription factors
- BRD4_HUMAN ERG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 2.15 | -0.53 | 2.33 | n/a | n/a | |||
| ERG_HUMAN | 1.16 | n/a | 1.50 | -5.66 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Esophagus_Gastroesophageal_Junction, Muscle_Skeletal, Testis