rs150298 chr15:89399809 G>A
- Sequence
ctactcctctggcccggagaccca[G/A]gacctcgtccgcactccaactctc
- ASB in cell types
- GM23248 PANC1 (pancreatic ductal adenocarcinoma) GM12878 (female B-cells lymphoblastoid cell line) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- EZH2_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 0.01 | 1.77 | 1.28 | n/a | n/a | |||
| CTCF_HUMAN | 1.40 | 0.61 | 1.24 | n/a | No Hit |
Items per page:
1 – 2 of 2