rs150396 chr6:98514715 C>T
- Sequence
cagaagtttctgctgcttcataga[C/T]tgtgcaacaaagggtttgttcctc
- ASB in cell types
- H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | -2.10 | 2.08 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hypertension (early onset hypertension), schizophrenia