rs152189 chr5:62384621 T>C
- Sequence
atatccagttgagagccactgtta[T/C]tgaaagatagcttatcttcacagc
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 2.50 | -4.37 | 1.75 | 0.06 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, ldl cholesterol change with statins, obesity with early age of onset (age >2), salmonella-induced pyroptosis, simpson-angus scale, total cholesterol change with statins, type 2 diabetes, type 2 diabetes, gender differentiated