rs1531558 chr16:7137945 G>A
- Sequence
gctaattaaatactcaatatttca[G/A]tgagttagcctctattttcatggt
- ASB in cell types
- SU-DHL-1 (Anaplastic large cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SU-DHL-1 (Anaplastic large cell lymphoma) | 1.79 | 0.01 | 2.00 |
Items per page:
1 – 1 of 1