rs1532251 chr1:94720831 G>A
- Sequence
tgagcccaggagttcaagaccagc[G/A]tgggcaacacagcaaaaccccatc
- ASB in cell types
- GM02630 (Fanconi anemi) MOLM14 (Adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | 1.59 | -0.82 | 1.00 | |||
| MOLM14 (Adult acute myeloid leukemia) | 1.12 | -0.31 | 1.00 |
Items per page:
1 – 2 of 2