rs1541010 chr10:13713544 C>T
- Sequence
gactggcacttgcaaatctttaga[C/T]ggatttacattttcagcaaataca
- ASB in cell types
- macrophages form periferal blood
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.46 | 0.42 | 1.66 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
PheWAS abdominal pain, acute laryngitis and tracheitis, adverse effects of hormones and synthetic substitutes, adverse effects of opiates and related narcotics in therapeutic use, allergic rhinitis, appendiceal conditions, appendicitis, bipolar, bladder neck obstruction, breast cancer, breast cancer, including in situ, breast disorder nos, cachexia, calcium/phosphorus disorders, cancer of the digestive organs and peritoneum, cerebral aneurysm, conduct disorders, congenital musculoskeletal anomalies, contracture of joint, cystic kidney disease, diabetes mellitus, diseases of respiratory system, disorders of muscle, ligament, and fascia, diverticulitis, duodenitis, edema, epistaxis or throat hemorrhage, fasciitis, fractur of unspecified part of femur, fracture of pelvis, fracture of unspecified bones, gastric ulcer, gastritis and duodenitis, nos, herpes zoster, hyperbilirubinemia, internal derangement of knee, intracerebral hemorrhage, lichen, light-headedness and vertigo, lyme disease, lymphadenitis, malignant neoplasm of kidney and other urinary organs, methicillin sensitive staphylococcus aureus, miscarriage, stillbirth, muscle weakness, muscular wasting and disuse atrophy, neoplasm of uncertain behavior, non-healing surgical wound, noninflammatory disorders of vagina, open wounds of head, neck, and trunk, other disorders of thyroid, other open wound of head and face, painful respiration, palpitations, persistent mental disorders due to other conditions, phobia, polycythemia vera, secondary, primary thrombocytopenia, renal osteodystrophy, respiratory complications, salicylates causing adverse effects in therapeutic use, schizophrenia, senile dementia, spermatocele, spirochetal infection, subarachnoid hemorrhage (injury), swelling, mass, or lump in head and neck, systemic sclerosis, toxic effect of venom, type 2 diabetes, unspecified monoarthritis, vertiginous syndromes and other disorders of vestibular system