rs1541364 chr5:137567007 G>A
- Sequence
ttaggccagaactaagaaccaggc[G/A]ggaacttggacaggcatggagtag
- ASB in cell types
- monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | n/a | 2.60 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, chronic kidney disease, cystatin c in serum, major depressive disorder (broad definition), major depressive disorder (broad definition) (males), microalbuminuria, refractive error, serum creatinine, sporadic creutzfeldt-jakob disease, waist hip ratio