rs1557271 chr21:34695476 T>C
- Sequence
tagtacatggacatctttgagagg[T/C]cattattcttcctactgcacgagt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- RUNX3_HUMAN IKZF2_HUMAN RELB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RUNX3_HUMAN | 2.63 | -2.67 | 1.00 | n/a | No Hit | |||
| IKZF2_HUMAN | -0.74 | 1.55 | 1.00 | n/a | n/a | |||
| RELB_HUMAN | -1.95 | 2.39 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen