rs155796 chr5:179906740 G>A
- Sequence
agtctcttccacatgaagaaacgt[G/A]gcccaggagaagcctccgtctgca
- ASB in cell types
- VCaP (prostate carcinoma) LHSAR (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 1.53 | 0.28 | 2.09 | |||
| LHSAR (prostate epithelial cells) | -0.17 | 1.76 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood