rs1561073 chr3:11600640 T>A
- Sequence
atacctctgtcagtgtcttatgac[T/A]gaacacaacagtccaagctgactg
- ASB in cell types
- G401 (rhabdoid tumor of the kidney) T47D (invasive ductal carcinoma) HCASMC (Human coronary artery smooth muscle cells) HEK293 (embryonic kidney)
- ASB for transcription factors
- TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | -0.34 | 1.79 | 1.75 | n/a | n/a |
Items per page:
1 – 1 of 1