rs1572905 chr9:107422364 G>A
- Sequence
gcccagactgagcacgtgatggca[G/A]aggaaaggaagccctgcttcctcc
- ASB in cell types
- WA09 (embryonic stem cells) hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA09 (embryonic stem cells) | 1.66 | 0.12 | 1.33 | |||
| hepatocytes | 1.44 | -0.01 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, ldl cholesterol change with statins, total cholesterol change with statins