rs15754 chr20:58894172 C>G
- Sequence
aatgatcttaaaataatttttcag[C/G]cacatttcataaatgtggaaactg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- RAD51_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD51_HUMAN | -2.43 | 2.54 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid