rs159074 chr5:56319405 T>G
- Sequence
ccttgccaacccccagcccccaga[T/G]ctcagtccggtgccccaggcagca
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 1.56 | -0.56 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, diastolic blood pressure (dbp), hdl cholesterol change with statins, ldl cholesterol, obesity with early age of onset (age >2), rheumatoid arthritis, systolic blood pressure (sbp), total cholesterol