rs160632 chr5:97167819 C>T
- Sequence
tccgttcactttcattttctgacc[C/T]gtaaacctctgctttttctgccac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.90 | 0.47 | 1.10 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, cystatin c in serum, longstanding arthritis, neuroblastoma (brain cancer), rheumatoid arthritis
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Thyroid