rs1609682 chr2:112782628 G>T
- Sequence
tagtgagggtaaaacaaaagtatt[G/T]aagattcaagtcattgctgttctc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) primary human epidermal keratinocytes
- ASB for transcription factors
- BRD4_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 1.82 | -0.12 | 1.00 | n/a | n/a | |||
| FOXK2_HUMAN | n/a | 2.44 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, fasting blood glucose, obesity with early age of onset (age >2), serum creatinine
GTEx eQTL Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid