rs16110 chr7:24299389 G>C
- Sequence
gagctattcgtccctgggggctca[G/C]gtgactgtcagagatcaagtgttg
- ASB in cell types
- ICN12 (primary pre-B acute lymphomablastic leukemia) A-673 clone Asp114 (Ewing sarcoma)
- ASB for transcription factors
- PBX1_HUMAN FLI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PBX1_HUMAN | -3.77 | 2.47 | 1.33 | n/a | No Hit | |||
| FLI1_HUMAN | n/a | 2.59 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2