rs162331 chr2:38092452 C>T
- Sequence
ggcctcagacctggggcatacagc[C/T]catttgacagccacaatgagggaa
- ASB in cell types
- A549 (lung carcinoma) hMADS-3 (adipose-derived stem cells) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- MAFK_HUMAN PPARG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAFK_HUMAN | 2.98 | -2.78 | 1.00 | n/a | No Hit | |||
| PPARG_HUMAN | 1.84 | -1.37 | 1.75 | n/a | No Hit |
Items per page:
1 – 2 of 2