rs16238 chr17:39118797 C>A
- Sequence
gcctacaatctacagcttgtgcag[C/A]ctgagccaatcagatcaccacccg
- ASB in cell types
- macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 1.59 | -0.80 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, infant head circumference, ldl cholesterol, recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (females), schizophrenia, total cholesterol, years of education