rs163084 chr2:38063773 G>A
- Sequence
aacagacacttctcatactgtagc[G/A]ttttgcactttcccaagcaatgta
- ASB in cell types
- monocyte-derived dendritic cells monocyte-derived macrophages from peripheral blood
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | -0.01 | 1.66 | 1.00 | |||
| monocyte-derived macrophages from peripheral blood | 2.66 | -1.87 | 2.00 |
Items per page:
1 – 2 of 2