rs163824 chr5:14109445 C>T
- Sequence
atcttgagagatcaaagtggcttt[C/T]tcaagagaccacagccagttagtg
- ASB in cell types
- breast tumor HS-SY-2(Monophasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.19 | -0.12 | 2.00 | |||
| HS-SY-2(Monophasic synovial sarcoma) | -1.15 | 1.98 | 1.50 |
Items per page:
1 – 2 of 2