rs163913 chr19:6722624 C>T
- Sequence
atgttgggtcaatctctgaatgca[C/T]tggtaatcttgctagatattgcca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | -0.11 | 1.30 | 1.11 | |||
| MCF7 (Invasive ductal breast carcinoma) | 2.56 | n/a | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, fasting insulin, homa-b, homa-ir, plasma brain natriuretic peptide (bnp), response to chronic hepatitis c interferon-alpha and ribavirin therapy
GTEx eQTL Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood