rs164632 chr19:4139852 C>T
- Sequence
gaggtgggagccatagaagatttc[C/T]ggcagaggagggacaggctctgac
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma) neutrophils from periferal blood HepG2 (hepatoblastoma)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.14 | 1.07 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, hdl cholesterol, microalbuminuria, mitral annular calcium, primary rhegmatogenous retinal detachment, simpson-angus scale, total cholesterol, triglycerides change with statins, variant creutzfeldt-jakob disease