rs1647392 chr15:56821725 G>A
- Sequence
acagactatgaaaagaaatgtgta[G/A]ggaattgtctaatgaattccagga
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 0.96 | -0.78 | 1.00 | |||
| adrenal gland | 1.85 | -1.55 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, fasting insulin, homa-ir, ldl cholesterol, neuroticism, simpson-angus scale, total cholesterol, triglycerides, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Minor_Salivary_Gland, Nerve_Tibial, Ovary, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid