rs16478 chr7:24284989 G>A
- Sequence
tgcactctcgccgcgcgcttcttg[G/A]tccctgagacttcgaacgaagttg
- ASB in cell types
- glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | n/a | 2.91 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, comorbid depressive syndrome and alcohol dependence, cystatin c in serum, fasting blood glucose, height