rs16530 chr17:39200781 C>T
- Sequence
cttgactccattcactcctttggc[C/T]tctcataaaggaaatctctgcgaa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.04 | 0.42 | 1.15 | |||
| K562 (myelogenous leukemia) | 0.62 | 0.11 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), asthma, bipolar disorder, hdl cholesterol, spine bone mineral density (bmd), years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg