rs1662160 chr11:20132542 G>A
- Sequence
gataacccttttgaaacctcccct[G/A]tttgggacaggccgtgctcccacc
- ASB in cell types
- GBM39 (Human brain tumor) GM12890 (Lymphoblastoid Cell Lines) CTV-1 (Adult T acute lymphoblastic leukemia) D54 (H54, Human glioblastoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.58 | 0.79 | 1.31 | n/a | No Hit |
Items per page:
1 – 1 of 1