rs16830309 chr1:25026970 C>A
- Sequence
tggtcggccgtgcctcacccagca[C/A]tcagctctgatcagacgtggagct
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -0.58 | 1.62 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | 1.54 | -1.11 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | 1.58 | -0.31 | 1.11 |
Items per page:
1 – 3 of 3