rs168333 chr3:11185774 G>A
- Sequence
ggtgtttgtaaaccctgcggtgtc[G/A]tgttggtgcacatgtgtggaggag
- ASB in cell types
- HKC8 (kidney proximal tubule cell line) MS-1 (Small cell lung carcinoma) Ishikawa (endometrial adenocarcinoma)
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | -0.08 | 1.14 | 1.95 | n/a | n/a |
Items per page:
1 – 1 of 1