rs16839055 chr3:132291037 C>T
- Sequence
accttgccttcataattgccattc[C/T]ttacccttttgctgaagctcttgc
- ASB in cell types
- macrophages form periferal blood SEM (childhood B acute lymphoblastic leukemia) monocyte-derived dendritic cells
- ASB for transcription factors
- FLI1_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FLI1_HUMAN | 2.30 | -1.98 | 1.00 | n/a | No Hit | |||
| TF65_HUMAN | 2.32 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2